Top » Catalog » SNPs » Z46066

$18.00

Z46066
[Z46066]

Z46066
hg38 Position: ChrY:12805483..12805483
Ancestral: C
Derived: T
Reference: Ray Banks (2018)
ISOGG Haplogroup: G
Comments: down from FGC41981
Forward Primer: Z46066_F TTGTCTGCTTGATGGTGTCC
Reverse Primer: Z46066_R TGATATGCTGCCTTGCAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies