Top » Catalog » SNPs » A22675

$18.00

A22675
[A22675]

A22675
hg38 Position: ChrY:19467233..19467233
Ancestral: T
Derived: A
Reference: Igor Schein (2018)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1b2b1a1b
Comments: Downstream A12255
Forward Primer: A22675_F TTGCCATCAGCATTCTCAAC
Reverse Primer: A22675_R TTCCCCATGTCTCTTTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies