Top » Catalog » SNPs » BY120162

$18.00

BY120162
[BY120162]

BY120162
hg38 Position: ChrY:16002483..16002483
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: BY120162_F TACAGATGTTCCCCCAAAGC
Reverse Primer: BY120162_R CTACTACGTGGGAGGCCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies