Top » Catalog » SNPs » Y128673

$18.00

Y128673
[Y128673]

Y128673
hg38 Position: ChrY:13263943..13263943
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y128673_F AGGCATATTGTGGCCTTCTG
Reverse Primer: Y128673_R CATGAATGAAGCTGGGAACC
Reviews

Customers who bought this product also purchased
Y128985
Y128985
Y129096
Y129096
Y128031
Y128031
Y128226
Y128226
Y130075
Y130075
Y130251
Y130251
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies