Top » Catalog » SNPs » Y128673

$18.00

Y128673
[Y128673]

Y128673
hg38 Position: ChrY:13263943..13263943
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y128673_F AGGCATATTGTGGCCTTCTG
Reverse Primer: Y128673_R CATGAATGAAGCTGGGAACC
Reviews

Customers who bought this product also purchased
Y129297
Y129297
Y128994
Y128994
Y130198
Y130198
Y130248
Y130248
Y129479
Y129479
R1b-FGC13326* to Terry
R1b-FGC13326* to Terry
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies