Honichtopf
Cart Contents
Checkout
My Account
Top
»
Catalog
»
SNPs
»
Y129297
$19.00
Y129297
[Y129297]
hg38 Position:
ChrY:20963653..20963653
Ancestral:
G
Derived:
A
Reference:
YFull (2018)
ISOGG Haplogroup:
R1b
Comments:
.
Forward Primer:
Y129297_F CACATCACCTCAGTGCTTGG
Reverse Primer:
Y129297_R TCTCTCTTGCTGCCCTCAAC
Add to Cart
Reviews
Customers who bought this product also purchased
Y129192
Y130248
Y128994
Y130198
Y128673
Y129479
Categories
Y Haplogroup Panels
(96)
Y Custom SNP Panels
(214)
SNPs
(413753)
Y-STR Beginner Panels
(3)
Y-STR Enhanced Panels->
(6)
Y-STRs
(126)
mtDNA Beginner Tests
(3)
mtDNA Enhanced Tests->
(31)
NGS Tests->
(5)
Various
(5)
Haplogroups
Please Select
A0
A00
A1a
A1b
A1b1
B
C
D
E
G
H
I1
I2
J1
J2
L
LT
M
N
O
other
Q
R1a
R1b
R2
S
T
Quick Find
Use keywords to find the product you are looking for.
Advanced Search
Reviews
Write a review on this product!
Information
Shipping & Returns
Privacy Notice
Conditions of Use
F.A.Q.
Contact Us
Impressum
Currencies
U.S. Dollar
Euro