Top » Catalog » SNPs » Y129297

$19.00

Y129297
[Y129297]

Y129297
hg38 Position: ChrY:20963653..20963653
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y129297_F CACATCACCTCAGTGCTTGG
Reverse Primer: Y129297_R TCTCTCTTGCTGCCCTCAAC
Reviews

Customers who bought this product also purchased
Y129192
Y129192
Y130248
Y130248
Y128994
Y128994
Y130198
Y130198
Y128673
Y128673
Y129479
Y129479
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies