Top » Catalog » SNPs » Y129297

$18.00

Y129297
[Y129297]

Y129297
hg38 Position: ChrY:20963653..20963653
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y129297_F CACATCACCTCAGTGCTTGG
Reverse Primer: Y129297_R TCTCTCTTGCTGCCCTCAAC
Reviews

Customers who bought this product also purchased
Y130198
Y130198
Y128673
Y128673
Y129479
Y129479
R1b-FGC13326* to Terry
R1b-FGC13326* to Terry
FGC13326
FGC13326
Y128985
Y128985
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies