Top » Catalog » SNPs » Y129479

$18.00

Y129479
[Y129479]

Y129479
hg38 Position: ChrY:7010155..7010155
Ancestral: C
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y129479_F GGCAACAAGAGCAAAACTCC
Reverse Primer: Y129479_R TCTGGCTTCATTTTGAGTGC
Reviews

Customers who bought this product also purchased
Y130198
Y130198
Y128673
Y128673
Y129096
Y129096
R1b-FGC13326* to Terry
R1b-FGC13326* to Terry
FGC13326
FGC13326
Y128985
Y128985
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies