Top » Catalog » SNPs » Y130198

$18.00

Y130198
[Y130198]

Y130198
hg38 Position: ChrY:19702318..19702318
Ancestral: T
Derived: C
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y130198_F AAGTGGCGGGTGAATGG
Reverse Primer: Y130198_R GATATTCAAAGGCATAGTATGTCTTAAAAC
Reviews

Customers who bought this product also purchased
Y128977
Y128977
Y128458
Y128458
Y129297
Y129297
Y128994
Y128994
Y129192
Y129192
Y130248
Y130248
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies