Top » Catalog » SNPs » BY67806

$18.00

BY67806
[BY67806]

BY67806
hg38 Position: ChrY:7936763..7936763
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY67806_F GGGCACTGTTAAGAAACTCTGC
Reverse Primer: BY67806_R ACGTGACTCTATTTTTGTCTGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies