Top » Catalog » SNPs » Y88012

$18.00

Y88012
[Y88012]

Y88012
hg38 Position: ChrY:8924262..8924262
Ancestral: G
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: E
Comments: Below CTS9320 > Z17017 > Z38456 > BY4461 > Y92017
Forward Primer: Y88012_F CTTGTCCTCAATGGCAGTTG
Reverse Primer: Y88012_R GACTCCCTGATCCAAATTCACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies