Top » Catalog » SNPs » A22698

$18.00

A22698
[A22698]

A22698
hg38 Position: ChrY:16450478..16450478
Ancestral: C
Derived: G
Reference: Bruce Cockburn (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A22698_F AGGACCTGTGTTGGTGGTTG
Reverse Primer: A22698_R GGGGACAAGGTCTCATTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies