Top » Catalog » SNPs » FGC3891

$18.00

FGC3891
[FGC3891]

FGC3891
hg38 Position: ChrY:19223813..19223813
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a2a1a1a (not listed)
Comments: Downstream of FGC7917/L217.1/S1849.1
Forward Primer: FGC3891_F GTTGAACTTTGAGATCAAGTGGTC
Reverse Primer: FGC3891_R CAAGGTGGTGTCCCTCTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies