Top » Catalog » SNPs » Y140446

$18.00

Y140446
[Y140446]

Y140446
hg38 Position: ChrY:19571883..19571883
Ancestral: A
Derived: C
Reference: YFull (2018)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1b2b1
Comments: Below Y17225
Forward Primer: Y140446_F TACGGGAGGATGTGTGTAGG
Reverse Primer: Y140446_R GAACCTTCTCAGGGCTGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies