Top » Catalog » SNPs » S15335

$18.00

S15335
[S15335]

S15335
hg38 Position: ChrY:11900776..11900776
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b
Comments: Below Z19
Forward Primer: S15335_F GTGGGCAGGGGTGGTTAG
Reverse Primer: S15335_R TTACATTCCCACCAAGCTCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies