Top » Catalog » SNPs » Z4883

$18.00

Z4883
[Z4883]

Z4883
hg38 Position: ChrY:11056264..11056264
Ancestral: G
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: N (not listed)
Comments: equiv to Tat
Forward Primer: Z4883_F GCAAACACTAAAACCCTGGC
Reverse Primer: Z4883_R GGCAGCCTCTTACTAATCTCCC
Reviews

Customers who bought this product also purchased
FGC5427
FGC5427
FT293359
FT293359
FGC67919
FGC67919
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS8984
ZS8984
FGC45682
FGC45682
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies