Top » Catalog » SNPs » Z4883

$18.00

Z4883
[Z4883]

Z4883
hg38 Position: ChrY:11056264..11056264
Ancestral: G
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: N (not listed)
Comments: equiv to Tat
Forward Primer: Z4883_F GCAAACACTAAAACCCTGGC
Reverse Primer: Z4883_R GGCAGCCTCTTACTAATCTCCC
Reviews

Customers who bought this product also purchased
FGC1695
FGC1695
FGC6770
FGC6770
FT126929
FT126929
FGC2
FGC2
A27198
A27198
ZS12043
ZS12043
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies