Top » Catalog » SNPs » FGC35194

$18.00

FGC35194
[FGC35194]

FGC35194
hg38 Position: ChrY:11868650..11868650
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: FGC35194_F TGAAATGAACTAAGACACCTGATAAG
Reverse Primer: FGC35194_R TCAGAAACAGAATCTTGTGCCAC
Reviews

Customers who bought this product also purchased
R1b-S21607 Panel
R1b-S21607 Panel
A765
A765
A769
A769
A763
A763
A768
A768
A762
A762
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies