Top » Catalog » SNPs » FGC35194

$18.00

FGC35194
[FGC35194]

FGC35194
hg38 Position: ChrY:11868650..11868650
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: FGC35194_F TGAAATGAACTAAGACACCTGATAAG
Reverse Primer: FGC35194_R TCAGAAACAGAATCTTGTGCCAC
Reviews

Customers who bought this product also purchased
A763
A763
A768
A768
A762
A762
A767
A767
S21607
S21607
A766
A766
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies