Top » Catalog » SNPs » Y139319

$18.00

Y139319
[Y139319]

Y139319
hg38 Position: ChrY:6849655..6849655
Ancestral: C
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: Below L48 > Z330 > Y21406
Forward Primer: Y139319_F CTTTTAAAATAGATTTTGAATCTGCTTG
Reverse Primer: Y139319_R CAACTGGGGAAAGACCATCTATC
Reviews

Customers who bought this product also purchased
Y152662
Y152662
DNA Sample Kit
DNA Sample Kit
Y139328
Y139328
Y139310
Y139310
Y139333
Y139333
Y139321
Y139321
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies