Top » Catalog » SNPs » Y139328

$18.00

Y139328
[Y139328]

Y139328
hg38 Position: ChrY:19295000..19295000
Ancestral: C
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: Below L48 > Z330 > Y21406
Forward Primer: Y139328_F CACATTTAATTGATTATATCAAGCCAC
Reverse Primer: Y139328_R ACAGAAGCAGGTATAACATTTTGAGTATC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
BY164465
BY164465
Y139319
Y139319
Y139333
Y139333
Y139321
Y139321
BY154039
BY154039
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies