Top » Catalog » SNPs » BY110858

$18.00

BY110858
[BY110858]

BY110858
hg38 Position: ChrY:14778320..14778320
Ancestral: G
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: Downstream Y12073
Forward Primer: BY110858_F TGACAGCACAAAACCCTGTC
Reverse Primer: BY110858_R CCATGCAAGTCCCAGAGAG
Reviews

Customers who bought this product also purchased
BY112989
BY112989
BY84561
BY84561
BY116706
BY116706
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies