Top » Catalog » SNPs » BY112989

$18.00

BY112989
[BY112989]

BY112989
hg38 Position: ChrY:15089045..15089045
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: Downstream Y12073
Forward Primer: BY112989_F ATTCCCTCTTCATCCCCTCAC
Reverse Primer: BY112989_R ACCCAAATAAATCCCACTGAGAAG
Reviews

Customers who bought this product also purchased
BY116706
BY116706
BY110858
BY110858
BY84561
BY84561
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies