Top » Catalog » SNPs » S5944

$18.00

S5944
[S5944]

S5944
hg38 Position: ChrY:10625781..10625781
Ancestral: A
Derived: C
Reference: (Jim Wilson 2018)
ISOGG Haplogroup: R1b
Comments: Below L48, with S6898
Forward Primer: S5944_F GAGTTTGTCAGAATATTTCTGTGTCC
Reverse Primer: S5944_R ATCTCACAGAGTTGAACCTTAATTTCC
Reviews

Customers who bought this product also purchased
S6911
S6911
R1b-S6898 Stout Panel
R1b-S6898 Stout Panel
S5955
S5955
S6910
S6910
S5953
S5953
S6907
S6907
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies