Top » Catalog » SNPs » S5947

$18.00

S5947
[S5947]

S5947
hg38 Position: ChrY:8117642..8117642
Ancestral: T
Derived: A
Reference: (Jim Wilson 2018)
ISOGG Haplogroup: R1b
Comments: Below L48, with S6898
Forward Primer: S5947_F ATACACACATATGTTTATTGTGGCG
Reverse Primer: S5947_R TCTTACAAACACATGGAAAAAAACAAG
Reviews

Customers who bought this product also purchased
S5943
S5943
S5957
S5957
S6911
S6911
R1b-S6898 Stout Panel
R1b-S6898 Stout Panel
S5955
S5955
S6910
S6910
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies