Top » Catalog » SNPs » S5947

$18.00

S5947
[S5947]

S5947
hg38 Position: ChrY:8117642..8117642
Ancestral: T
Derived: A
Reference: (Jim Wilson 2018)
ISOGG Haplogroup: R1b
Comments: Below L48, with S6898
Forward Primer: S5947_F ATACACACATATGTTTATTGTGGCG
Reverse Primer: S5947_R TCTTACAAACACATGGAAAAAAACAAG
Reviews

Customers who bought this product also purchased
S5952
S5952
S6899
S6899
S5944
S5944
S6897
S6897
S6912
S6912
S5943
S5943
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies