Top » Catalog » SNPs » S5952

$18.00

S5952
[S5952]

S5952
hg38 Position: ChrY:20846588..20846588
Ancestral: T
Derived: C
Reference: (Jim Wilson 2018)
ISOGG Haplogroup: R1b
Comments: Below L48, with S6898
Forward Primer: S5952_F TTAGAGACTAGGATTGCAATGGCC
Reverse Primer: S5952_R AAAAACATGCCAAAGTGTAAAGACTG
Reviews

Customers who bought this product also purchased
S6907
S6907
S5947
S5947
S6899
S6899
S5944
S5944
S6897
S6897
S6912
S6912
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies