Top » Catalog » SNPs » S6899

$18.00

S6899
[S6899]

S6899
hg38 Position: ChrY:14256832..14256832
Ancestral: G
Derived: A
Reference: (Jim Wilson 2018)
ISOGG Haplogroup: R1b
Comments: Below L48, with S6898
Forward Primer: S6899_F CATTCTGTGGTTGCAAACAAGTAG
Reverse Primer: S6899_R ATCCAATCAAATTGACACCCAG
Reviews

Customers who bought this product also purchased
S5953
S5953
S6910
S6910
S5952
S5952
S6907
S6907
S5947
S5947
S6897
S6897
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies