Top » Catalog » SNPs » S6899

$18.00

S6899
[S6899]

S6899
hg38 Position: ChrY:14256832..14256832
Ancestral: G
Derived: A
Reference: (Jim Wilson 2018)
ISOGG Haplogroup: R1b
Comments: Below L48, with S6898
Forward Primer: S6899_F CATTCTGTGGTTGCAAACAAGTAG
Reverse Primer: S6899_R ATCCAATCAAATTGACACCCAG
Reviews

Customers who bought this product also purchased
S6912
S6912
S5943
S5943
S5955
S5955
S6911
S6911
R1b-S6898 Stout Panel
R1b-S6898 Stout Panel
S5953
S5953
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY32561
1 x A24018
$36.00
Haplogroup Info
Other products
Currencies