Top » Catalog » SNPs » S14084

$18.00

S14084
[S14084]

S14084
hg38 Position: ChrY:11316691..11316691
Ancestral: G
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: S14084_F GGAGGCTCGCCTTGTG
Reverse Primer: S14084_R ACGGGAATTTTCACATATCTCTATG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
S14083
S14083
Whole Genome Sequence
Whole Genome Sequence
S14082
S14082
BY42595
BY42595
DYS390
DYS390
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies