Top » Catalog » SNPs » S14084

$18.00

S14084
[S14084]

S14084
hg38 Position: ChrY:11316691..11316691
Ancestral: G
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: S14084_F GGAGGCTCGCCTTGTG
Reverse Primer: S14084_R ACGGGAATTTTCACATATCTCTATG
Reviews

Customers who bought this product also purchased
S14082
S14082
BY42595
BY42595
DYS390
DYS390
YSEQ-Alpha
YSEQ-Alpha
DNA Sample Kit
DNA Sample Kit
S14083
S14083
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies