Top » Catalog » SNPs » BY57169

$18.00

BY57169
[BY57169]

BY57169
hg38 Position: ChrY:3025314..3025314
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below P312 > ZZ38 > Z29645
Forward Primer: BY57169_F TGCCTAGGCCTCTCAAAGTC
Reverse Primer: BY57169_R AATGAAACCAAAAGCTGGTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies