Top » Catalog » SNPs » BY62223

$18.00

BY62223
[BY62223]

BY62223
hg38 Position: ChrY:7056750..7056750
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below P312 > ZZ38 > Z29645
Forward Primer: BY62223_F ATTGCCTATTACCCCCAAGG
Reverse Primer: BY62223_R TCAGGGATAAAACCCCCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies