Top » Catalog » SNPs » BY74270

$18.00

BY74270
[BY74270]

BY74270
hg38 Position: ChrY:8717824..8717824
Ancestral: T
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below P312 > ZZ38 > Z29645
Forward Primer: BY74270_F CAGGAGGAAAGAACCCTAGAGC
Reverse Primer: BY74270_R TTTGATGAACTAAGTTGCTAGAAATATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies