Top » Catalog » SNPs » FGC30244

$18.00

FGC30244
[FGC30244]

FGC30244
hg38 Position: ChrY:12818097..12818097
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC30244_F TATGCTCCCGTACCTTCCAC
Reverse Primer: FGC30244_R CGAAAGAAGCTGAAACAAATACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30566
$18.00
Haplogroup Info
Other products
Currencies