Top » Catalog » SNPs » ZS1585

$18.00

ZS1585
[ZS1585]

ZS1585
hg38 Position: ChrY:15708817..15708817
Ancestral: C
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample 205666; downstream FGC8223
Forward Primer: ZS1585_F ATGTTTGGCAATGTCGGAAC
Reverse Primer: ZS1585_R AGATGCTACATCCAGGCAGTTAC
Reviews

Customers who bought this product also purchased
BY89
BY89
FGC11
FGC11
FGC1695
FGC1695
ZS5606
ZS5606
L858
L858
ZS1559
ZS1559
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies