Top » Catalog » SNPs » ZS1585

$18.00

ZS1585
[ZS1585]

ZS1585
hg38 Position: ChrY:15708817..15708817
Ancestral: C
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample 205666; downstream FGC8223
Forward Primer: ZS1585_F ATGTTTGGCAATGTCGGAAC
Reverse Primer: ZS1585_R AGATGCTACATCCAGGCAGTTAC
Reviews

Customers who bought this product also purchased
FGC8223
FGC8223
FGC22715
FGC22715
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS1576
ZS1576
ZS4020
ZS4020
FGC8216
FGC8216
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies