Top » Catalog » SNPs » ZS1585

$18.00

ZS1585
[ZS1585]

ZS1585
hg38 Position: ChrY:15708817..15708817
Ancestral: C
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample 205666; downstream FGC8223
Forward Primer: ZS1585_F ATGTTTGGCAATGTCGGAAC
Reverse Primer: ZS1585_R AGATGCTACATCCAGGCAGTTAC
Reviews

Customers who bought this product also purchased
FGC49240
FGC49240
ZS5597
ZS5597
ZS5604
ZS5604
FGC8223
FGC8223
YSC0000076
YSC0000076
FGC22715
FGC22715
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies