Top » Catalog » SNPs » ZS1585

$18.00

ZS1585
[ZS1585]

ZS1585
hg38 Position: ChrY:15708817..15708817
Ancestral: C
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample 205666; downstream FGC8223
Forward Primer: ZS1585_F ATGTTTGGCAATGTCGGAAC
Reverse Primer: ZS1585_R AGATGCTACATCCAGGCAGTTAC
Reviews

Customers who bought this product also purchased
FGC67895
FGC67895
FT262752
FT262752
FGC67896
FGC67896
Y18570
Y18570
M267
M267
FT164337
FT164337
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies