Top » Catalog » SNPs » Y47724

$18.00

Y47724
[Y47724]

Y47724
hg38 Position: ChrY:8806222..8806222
Ancestral: T
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y47724_F AGATAGTTCACCAGTTCTTGTACATGTG
Reverse Primer: Y47724_R CCAAGTGTACTAAGTAGTGACACCTGC
Reviews

Customers who bought this product also purchased
Y49987
Y49987
Y47739
Y47739
I2 Jerkovic Petrovdan Panel
I2 Jerkovic Petrovdan Panel
Y52621
Y52621
Y55817
Y55817
Y51455
Y51455
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies