Top » Catalog » SNPs » Y4781

$18.00

Y4781
[Y4781]

Y4781
hg38 Position: ChrY:7000689..7000689
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: Y4781_F GTTTTTAATTAGTCCAAGCAGAACC
Reverse Primer: Y4781_R GTGACGGCTCATGTCTGTAATC
Reviews

Customers who bought this product also purchased
FGC52382
FGC52382
A12275
A12275
R1b-FGC52382 Adams Panel
R1b-FGC52382 Adams Panel
FGC58785
FGC58785
A12274
A12274
A12277
A12277
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies