Top » Catalog » SNPs » FGC15529

$18.00

FGC15529
[FGC15529]

FGC15529
hg38 Position: ChrY:12321984..12321984
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a (not listed)
Comments: Below F1345 > CTS6 > Y2619 > Y2630
Forward Primer: FGC15529_F CCTCACAGTTGCCACCACC
Reverse Primer: FGC15529_R TCAGGCCCGGTACAGTAGAC
Reviews

Customers who bought this product also purchased
FGC15531
FGC15531
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies