Top » Catalog » SNPs » A22918

$18.00

A22918
[A22918]

A22918
hg38 Position: ChrY:8196608..8196608
Ancestral: A
Derived: G
Reference: Elfatih Salim (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A22918_F CTAGAACTCAGCATTAAGAAATATTCAG
Reverse Primer: A22918_R TTGCCTTAATTTCAGAACTGGTC
Reviews

Customers who bought this product also purchased
A22925
A22925
J1-ZS1820 Fazara II Panel
J1-ZS1820 Fazara II Panel
A22924
A22924
A22923
A22923
A22922
A22922
A22921
A22921
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
2 x A1523
2 x A1346
1 x A1642
$90.00
Haplogroup Info
Other products
Currencies