Top » Catalog » SNPs » A22924

$18.00

A22924
[A22924]

A22924
hg38 Position: ChrY:15372521..15372521
Ancestral: G
Derived: A
Reference: Elfatih Salim (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A22924_F TTCAAGCACTTCAAGCACGTC
Reverse Primer: A22924_R CATGTCATCCGCAAACAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies