Top » Catalog » SNPs » A22930

$18.00

A22930
[A22930]

A22930
hg38 Position: ChrY:18872172..18872172
Ancestral: C
Derived: A
Reference: Alex Buchanan (2018)
ISOGG Haplogroup: I1
Comments:
Forward Primer: A22930_F GAACCAGTCTGTTTTCTTTAAGAGG
Reverse Primer: A22930_R GCAAATGTCTGTGTGGGTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies