Top » Catalog » SNPs » Z27030

$18.00

Z27030
[Z27030]

Z27030
hg38 Position: ChrY:13108770..13108770
Ancestral: C
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: I2
Comments: Below Z27034
Forward Primer: Z27030_F AGTTACATTACTCTGCCATTAAACATTAGAG
Reverse Primer: Z27030_R CTGAGCAATACAGCAAGATCC
Reviews

Customers who bought this product also purchased
Z27034
Z27034
A19455
A19455
L160
L160
CTS4720
CTS4720
Y84185
Y84185
M26
M26
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies