Top » Catalog » SNPs » Z27030

$18.00

Z27030
[Z27030]

Z27030
hg38 Position: ChrY:13108770..13108770
Ancestral: C
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: I2
Comments: Below Z27034
Forward Primer: Z27030_F AGTTACATTACTCTGCCATTAAACATTAGAG
Reverse Primer: Z27030_R CTGAGCAATACAGCAAGATCC
Reviews

Customers who bought this product also purchased
M26
M26
A17271
A17271
A19300
A19300
I2a-CTS595 Panel
I2a-CTS595 Panel
CTS1758
CTS1758
PF4125
PF4125
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies