Top » Catalog » SNPs » Y105989

$19.00

Y105989
[Y105989]

Y105989
hg38 Position: ChrY:19132350..19132350
Ancestral: C
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: Below Z2103 > CTS1450 > Z2705 > Y37280
Forward Primer: Y105989_F TCCAGGATGTTGTCAAGCAG
Reverse Primer: Y105989_R GAAGGCAAGGGTCAGGGTAG
Reviews

Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies