Top » Catalog » SNPs » Y154840

$19.00

Y154840
[Y154840]

Y154840
hg38 Position: ChrY:13958798..13958798
Ancestral: A
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y154840_F ATTACTTTTGCTCCACTCTAATACAAATTG
Reverse Primer: Y154840_R ACACCCTAGGTGTCCTATGTGG
Reviews

Customers who bought this product also purchased
FGC2
FGC2
ZS10609
ZS10609
FTA8520
FTA8520
FGC5
FGC5
FGC22745
FGC22745
HU406
HU406
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies