Top » Catalog » SNPs » Y154841

$18.00

Y154841
[Y154841]

Y154841
hg38 Position: ChrY:7993168..7993168
Ancestral: C
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y154841_F TAAGTGTCCATGAAATCTTCATAATTTC
Reverse Primer: Y154841_R ATTTCTGTATAACCCCGTATTCCC
Reviews

Customers who bought this product also purchased
A22922
A22922
A22921
A22921
A22919
A22919
A22918
A22918
Y154840
Y154840
A22923
A22923
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies