Top » Catalog » SNPs » BY168509

$18.00

BY168509
[BY168509]

BY168509
hg38 Position: ChrY:20003887..20003887
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below P312 > ZZ37 > ZZ38 > S27900
Forward Primer: BY168509_F TTTGAAACAAATAACGATAATAACAGC
Reverse Primer: BY168509_R CCAGACTCATCCATGTTGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies